MAR

(redirected from IRF1)
Also found in: Dictionary, Thesaurus, Medical, Acronyms, Encyclopedia.

MAR

GOST 7.67 Latin three-letter geocode for Morocco. The code is used for transactions to and from Moroccan bank accounts and for international shipping to Morocco. As with all GOST 7.67 codes, it is used primarily in Cyrillic alphabets.
References in periodicals archive ?
The protein levels of IRF1, eIF2[alpha], ATF4, and PDL1 in the tumor tissues of the all subject group were significantly correlated with each other and formed a cluster in dendrogram (Figure 5).
Gene Primer (5'-3') forward Length (bp) and reverse NM_001038050 ISG12 F:cttcaccagtgcaggaatca 195 R:cccaaaaatttggacacgag NM_174366 ISG15 F:tgcagaactgcatctccatc 199 R:ttcatgaggccgtattcctc AF069133 ISG17 F:catttgggtgtgagcatttg 159 R:ttgctgatgggattgtgaaa NM_173940 MX1 F:gtccctgctaacgtggacat 155 R:accaggtttctcaccacgtc NM_173941.2 MX2 F:gcagatcaaggcactcatca 168 R:accaggtctggtttggtcag NM_177432.2 IRF1 F:gctgggacatcaacaaggat 163 R:ctgctctggtccttcacctc AJ490936.1 IRF2 F:aaactgggccatccatacag 192 R:ttagaaggccgctcagacat BC102948 ACTB F:ctcttccagccttccttcct 178 R:gggcagtgatctctttctgc
Effect of single nucleotide polymorphism of IRF1 gene on cytokine traits in three pig breeds.
The IL10, IL10RA, IL10RB, JAK1, STAT3, SOCS3, IP10, ICAM1, IFNA, IFNARA, IFNAR2, IFNG, IFNGR1, IFNGR2, STAT1, and IRF1 genes are important molecules associated with the host immunoinflammatory response.
tularensis-induced type I IFNs drive expression of transcription factor IRF1, that then causes expression of guanylate binding proteins (GBPs) [137,138].
Sixty-three percent of genes with increased H4ac are associated with the regulation by interferon regulatory factor 1 (IRF1), suggesting that interferon a (IFN[alpha]) contributes to the pathogenesis of SLE.
IFN-[gamma] induces the expression of IRF1 by the activation of the Janus kinases (jak) 1 and 2 and phosphorylation of Statl (JAK/STAT pathway) [19, 21].