Also found in: Dictionary, Thesaurus, Medical, Acronyms, Encyclopedia, Wikipedia.


Copyright © 2012, Campbell R. Harvey. All Rights Reserved.

Exchange Rate Mechanism

Used prior to the adoption of the euro, a method for reconciling differing exchange rates between currencies, allowing participation in the single European currency. Established in 1979, it was known as a "semi-pegged" system in which currencies were variable with respect to each other only within a certain range. After the introduction of the euro in 1999, the exchange rate mechanism was replaced by ERM II, which reconciles exchange rates for countries wishing to join the eurozone.
Farlex Financial Dictionary. © 2012 Farlex, Inc. All Rights Reserved
References in periodicals archive ?
COSO also offers several interesting "ERM Thought Papers" on its ERM Guidance web page.
A variety of factors have contributed to the widespread adoption of ERM, including enhanced concerns about systemic risks after the global financial crisis and improvements in technology related to risk quantification and tracking.
We cannot overstate the importance of our Comptroller Squadrons in the ERM profile, and without them the Wing would not have the resources, nor the support to carry out their mission.
According to the existing literature, ERM is an important element of an effective corporate governance system that encompasses activities and strategies which enable the company to identify, measure, reduce or exploit, as well as to control and monitor the exposure to various types of corporate risks --strategic, financial, operational, reporting as well as compliance risks.
Primers of erm A, B, C and 16SrRNA Primers Sequences (5'-3') Conc [T.sub.m] (Unit/[micro]l) Value erm A-F TATCTTATCGTTGAGAAGGGATT 3 57[degrees]C erm A-R CTACACTTGGCTTAGGATGAAA 3 53[degrees]C erm B-F TATCTGATTGTTGAAGAAGGATT 3 57[degrees]C erm B-R GTTTACTCTTGGTTTAGGATGAAA 3 57[degrees]C erm C-F CTTGTTGATCACGATAATTTCC 3 53[degrees]C erm C-R ATCTTTTAGCAAACCCGTATTC 3 53[degrees]C 16S-F GGAGGAAGGTGGGGATGACG 3 57C[degrees] 61S -R ATGGTGTGACGGGCGGTGTG 3 57C[degrees] Primers Length (bp) erm A-F 24 erm A-R 22 erm B-F 24 erm B-R 24 erm C-F 22 erm C-R 22 16S-F 20 61S -R 20 Table 2.
* Orange Book: Management of Risk--Principles and Concepts, by the Enterprise Risk Management Initiative (
Identifying, analyzing, prioritizing, dashboarding, reporting--the day-to-day tasks of running an enterprise risk program can make the ERM road pretty wide.
Enterprise Risk Management (ERM) and Firm Performance
"ERM transformed Intuit's risk management capability requiring our leaders to think cross-organizationally and cross-functionally to understand the most significant risks and drive strategies to address them," said Janet Nasburg, Intuit's chief risk officer.
In the early stages of ERM development the collagenous sheet shows a glistening, or sheen, and is described as a cellophane maculopathy.
The authors conclude that "the state of ERM in higher education leaves many institutions unprepared to address high-priority risks that may endanger the realization of strategic plans and institutional mission." In particular, they warn against addressing risk ad hoc--as when governing boards and cabinets discuss risks "as needed," rather than setting a schedule for regular updates and reports.