factor

(redirected from factor XIII)
Also found in: Dictionary, Thesaurus, Medical, Legal, Encyclopedia, Wikipedia.
Related to factor XIII: Corifact

Factor

A financial institution that buys a firm's accounts receivable and collects the accounts.

Factor

A third party that buys a firm's accounts receivable. If a firm is not confident in its ability to collect on its credit sales, it may sell the right to receive payment to the factor at a discount. The factor then assumes the credit risk associated with the accounts receivable. This provides the firm immediate access to working capital, which is important, especially if the firm has a cash flow problem. The price of factoring is determined by the creditworthiness of the firm's customer, not of the firm itself. It is also known as accounts receivable financing.

factor

A firm that purchases accounts receivable from another firm at a discount. The purchasing firm then attempts to collect the receivables.

factor

To sell accounts receivable to another party at a discount from face value. Thus, a firm in need of cash to pay down short-term debt may decide to factor its accounts receivable to another firm.

factor

  1. a firm that purchases TRADE DEBTS from client firms. See FACTORING.
  2. a firm that buys in bulk and performs a WHOLESALING function.
  3. an input (for example raw material, labour, capital) which is used to produce a good or provide a service.

factor

  1. 1a FACTOR INPUT that is used in production (see NATURAL RESOURCES, LABOUR, CAPITAL).
  2. a business that buys in bulk and performs a WHOLESALING function.
  3. a business that buys trade debts from client firms (at some agreed price below the nominal value of the debts) and then arranges to recover them for itself. See FACTOR MARKET, FACTORING.
References in periodicals archive ?
Factor XIII polymorphisms: The frequency of FXIII 103G/T polymorphism was 29% in the case group and 17% in the control group, (p > 0.
Acquired deficiencies of factor XIII have been described in association with drugs, chronic renal failure, hepatic cirrhosis, and lymphoproliferative disorders.
Mutation Primer Sequence, 5' - 3' Factor II G20210A PCR forward Biotin-CCTGAAGAAGTGGATACAGAAGG PCR reverse CAGTAGTATTACTGGCTCTTCCTGA Sequencing ACTGGGAGCATTGAG Factor V Leiden PCR forward GGGCTAATAGGACTACTTCTAATC (G1691A) PCR reverse Biotin-TCTCTTGAAGGAAATGCCCCATTA Sequencing AGCAGATCCCTGGAC MTHFR C677T PCR forward TTGAGGCTGACCTGAAGCAC PCR reverse Biotin-5GTGATGCCCATGTCGGTG Sequencing GGTGTCTGCGGGAG Factor XIII Val34Leu PCR forward AGCAGTTCCACCCAATAACTCT PCR reverse Biotin-TCATACCTTGCAGGTTGACG Sequencing CACAGTGGAGCTTCAG MTHFR A1298C PCR forward GTGGCACTGCCCTCTGTC PCR reverse Biotin-CTCCCGAGAGGTAAAGAACGA Sequencing AGGAGTTGACCAGTGA PAI-1 4G/5G PCR forward Biotin-GGCACAGAGAGAGTCTGGACAC PCR reverse CGCCTCCGATGATACACG Sequencing ACACGGCTGACTCCC
Alterations of haemostasis parameters with special reference to fibrin stabilization, factor XIII and fibronectin in patients with obliterative atherosclerosis.
Coagulation factor XIII plays an important role in the maintenance of haemostasis through cross-linking of fibrin and other coagulation molecules.
Completed a worldwide license of recombinant Factor XIII to Novo Nordisk A/S, facilitating the company's strategic product development objectives, while retaining a significant economic interest in the product candidate.
This transaction transfers recombinant Factor XIII (rFactor
He co-developed two NIR molecular probes for imaging thrombin and Factor XIII, and is currently developing a NIR fluorescence catheter to detect inflammation - a technology that holds great promise for applications in a wide range of therapies.
NovoSecure(TM) launched on March 26, 2015, and is open to people with hemophilia A, hemophilia A or B with inhibitors, congenital Factor VII deficiency, acquired hemophilia, Glanzmann's thrombasthenia, or congenital Factor XIII deficiency.
The coagulation factor concentrates segment is divided into factor VIII, factor IX, factor XIII, prothrombin coagulation concentrates, Von Willebrand factor, and fibrinogen concentrates.