NIF

(redirected from S100A8)
Also found in: Medical, Encyclopedia, Wikipedia.

NIF

Note Issuance Facility

An agreement by a syndicate of banks to buy short- and/or medium-term notes from an issuer in the event that it is unable to sell the notes on eurocurrency markets. This effectively provides credit for the issuer because, even if the issuer cannot place an issue, it will still be able to raise the funds it seeks. A note issuance facility thereby reduces the risk to an issuer of short- and medium-term debt securities.
Mentioned in ?
References in periodicals archive ?
S100A12 is produced mainly by granulocytes upon inflammatory activation and acts independently of S100A8 and S100A9 (17).
In the absence of ELISAs specific for the monomeric forms of S100A8 and S100A9 and of a commercially available test for S100A12, we have hypothesized that mass spectrometry (MS) might be a possible approach for detecting these proteins (22).
a) Gene Forward primer Reverse primer CDH1 AACGCATTGCCACATACACTCT CATTCTGATCGGTTACCGTGATC E2F1 GAGCAGATGGTTATGGTGATCAAA AGGGCACAGGAAAACATCGA GAPDH GGAGTCCCTGCCACACTCA GCCCCTCCCCTCTTCAAG GJA1 CCAAAGACTGTGGGTCTCAA CTCACTTGCTTGCTTGTTGTA HBEGF AGGACTTCTGCATCCATGGA TGGTCATAGGTATATAAGCGAT IGFBP5 CTCACTTGCTTGCTTGTTGTA GCACTGCTTTCTCTTGTAGAA IL1R2 TGTGCTGGCCCCACTTTC GCACAGTCAGACCATCTGCTTT IL8 GTGCAGTTTTGCCAAGGA TTCTGTGTTGGCGCAGTG KRT13 GCGGGACTACAGCCCCTACTAC CCAGCCTGGCATTGTCAAT MMP2 GCACTGCTTTCTCTTGTAGAA GATCTGAGCGATGCCATCAA PRSS11 CCGTGGTTCATATCGAATTGT CCGTGGTTCATATCGAATTGT S100A8 TGGAGAAAGCCTTGAACTCTATCA GGTCTCTAGCAATTTCTTCAGGTCAT THBD GAGGACGTGGATGACTGCATACT GGTACTCGCAGTTGGCTCTGA VAV3 GAACAAGGGACACTCAAACTACCA GTTCCTAATGACCTGCATCTTTGG (a) Primer sequences were designed by Primer Express 2.
The 2 S100A8 and S100A12 species each consisted of unmodified full-length and apparently truncated forms that have not previously been described.
Immunoblotting BALF samples with an anti-S100A8 antibody detected S100A8 and A8 * (Fig.
Differential detection of S100A8 in transitional cell carcinoma of the bladder by pair wise tissue proteomic and immunohistochemical analysis.
Human S100A8 and S100A9 were purchased from Bachem AG.