GR

(redirected from NR3C1)
Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.

GR

The two-character ISO 3166 country code for GREECE.

GR

1. ISO 3166-1 alpha-2 code for the Hellenic Republic (Greece). This is the code used in international transactions to and from Greek bank accounts.

2. ISO 3166-2 geocode for Greece. This is used as an international standard for shipping to Greece. Each subdivision has its own code with the prefix "GR." For example, the code for the Department of Arkadia is ISO 3166-2:GR-12.
References in periodicals archive ?
An NR3C1 diallelic single nucleotide polymorphism, Bcl-1, has been reported to distinguish individuals with the highest GC sensitivity.
1 CYP4B1 TGACCATGTGCATCAAAGGAG Other drug-metabolizing enzymes NM_000120 EPHX1 TGATGAGGGAGAGCGGGCTAC NM_002021 FMO1 GCTGTTCGAGTCCTGAAAGG NM_006894 FMO3 GGCAGGGCTAGCATTTACAA NM_001461 FMO5 CTCTCAGTTTCATATTGCCCAG NM_000846 GSTA2 GCCCAAGCTCCACTACTTCA NM_000561 GSTM1 TTCCCAATCTGCCCTACTTG XM_040116 GSTP1 ACCTCCGCTGCAAATACATC XM_003547 UGT2A1 TTGGCCAATGGAAGGTAGTC Nuclear transcription factors NM_001621 AHR CTGCCTTTCCCACAAGATGT NM_005122 NR1I3 GTCATGGCCAGTAGGGAAGA M10901 NR3C1 GCTCTGGGGTGGAGATCATA U22662 NR1H3 TCAACCCCATCTTCGAGTTC AF061056 NR1I2 TTGTTCGGCATCACAGGTAG Housekeeping gene NM_021130 Cyclophilin CTTGCCATTCCTGGACCCAA Product Accession no.
We obtained TaqMan[R] realtime reverse-transcription polymerase chain reaction (RT-PCR) primer probes from Applied Biosystems (Foster City, CA) and ON-TARGET plus[R] Control Pool (nontargeting pool) and SMARTpool (human NR3C1, ER[alpha], and ER[beta]) small-interfering RNA (siRNA) from Thermo Scientific (Waltham, MA).
In turn, there was a notable link between increased methylation of NR3C1 and weakened cortisol response to a standardized neuro-endocrine challenge test that is designed to evaluate aspects of neurotransmission function.